In recitation, we discussed that you will pick a protein for your homework that you find interesting. Which protein have you chosen and why? Using one of the tools described in recitation (NCBI, UniProt, google), obtain the protein sequence for the protein you chose.
Graphical summary of phage endolysin applications as promising antimicrobial agents. Graphic from Rahman et. al, 2021
The protein I have chosen is endolysin from the Escherichia phage. Endolysins are enzymes produced by bacteriophages (viruses that infect bacteria) during the viral reproductive cycle to degrade bacterial cell walls at the end of the cycle to release new virions.
I find endolysins interesting because there is potential for these enzymes to be used as a targeted antibacterial therapy. As antibiotic resistance increases, phage therapy has regained attention as a way to specifically eliminate pathogenic bacteria while preserving commensal microbes (human gut microbiome). Endolysins show specificity for bacteria like E. coli and have been investigated as an alternative treatment approach.
The amino acid sequence for endolysin [Escherichia phage vB_EcoS_AHP42]
NCBI: YP_009056567.1
Visualized with AlphaFold, Jumper et. al, 2021 and Varadi et. al, 2021
Visualized with AlphaFold, Jumper et. al, 2021 and Varadi et. al, 2021
Amino acid sequence-
<aside> <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/714b5296-ea68-4057-a101-501f78c09a95/e3ad39c9-8207-459c-b06f-09fdb3dd1825/3D_Structure_Endolysin_alphafold_.png" alt="https://prod-files-secure.s3.us-west-2.amazonaws.com/714b5296-ea68-4057-a101-501f78c09a95/e3ad39c9-8207-459c-b06f-09fdb3dd1825/3D_Structure_Endolysin_alphafold_.png" width="40px" /> MSIKNKVIGGVLGSAIAIAVPFLNKHEGVEYSPYKDVAGVWTICAGITGPDVIRGKVYTQRDCDALLMKHLSIHRSAVDKALKVDVPVSTRAALYSFSFNVGTNAMRNSTVIRLMNRGDIRGGCEALSMWNKISVGGKKVVSKGLVNRRNAEIRLCVSEL
</aside>
https://lh7-us.googleusercontent.com/Oz9VZaM9EFwpMFfUb8edYriE7svZ1dZgfG7KfxGaOArFT4ED1upb2S5-4765mZBXR04rchhw0l5kIhMqHC378v5fzyzZp6g9xeFOMp0el4uKb09CzAaP4Ag7v9yE8vZy0GhAheWGiUJdgPsmi2sR-Yw
By understanding the protein sequence and structure of endolysins we can engineer it to best harness as an antibacterial. With antibiotic effectiveness decreasing, I think phage endolysins show great promise which is why I chose to study this protein further. Endolysins offer targeted killing of only infected bacterial cells. In addition, resistance seems less likely to develop to these enzymes.
The Central Dogma discussed in class and recitation describes the process in which DNA sequence becomes transcribed and translated into protein. The Central Dogma gives us the framework to work backwards from a given protein sequence and infer the DNA sequence that the protein is derived from. Using one of the tools discussed in class, NCBI or online tools (google “reverse translation tools”), determine the nucleotide sequence that corresponds to the protein sequence you chose above.
Reverse translated via Benchling.com:
<aside> 🧬 ATGAGCATTAAAAACAAAGTGATTGGCGGCGTGCTGGGCAGCGCGATTGCGATTGCGGTGCCGTTTCTGAACAAACATGAAGGCGTGGAATATAGCCCGTATAAAGATGTGGCGGGCGTGTGGACCATTTGCGCGGGCATTACCGGCCCGGATGTGATTCGCGGCAAAGTGTATACCCAGCGCGATTGCGATGCGCTGCTGATGAAACATCTGAGCATTCATCGCAGCGCGGTGGATAAAGCGCTGAAAGTGGATGTGCCGGTGAGCACCCGCGCGGCGCTGTATAGCTTTAGCTTTAACGTGGGCACCAACGCGATGCGCAACAGCACCGTGATTCGCCTGATGAACCGCGGCGATATTCGCGGCGGCTGCGAAGCGCTGAGCATGTGGAACAAAATTAGCGTGGGCGGCAAAAAAGTGGTGAGCAAAGGCCTGGTGAACCGCCGCAACGCGGAAATTCGCCTGTGCGTGAGCGAACTG
</aside>
Once the nucleotide sequence of your protein is determined, you need to codon optimize your sequence. You may, once again, utilize google for a “codon optimization tool”. In your own words, describe why you need to optimize codon usage. Which organism have you chosen to optimize the codon sequence for and why?
